Stem-loop sequence mmu-mir-6374

AccessionMI0021903 (change log)
Symbol MGI:Mir6374
DescriptionMus musculus miR-6374 stem-loop
Stem-loop
   g    acc     u  g      - uu    gc     gg    ---ac      a 
5'  ucca   caggc ac uaagaa g  auaa  uaguu  ugcu     agagaa g
    ||||   ||||| || |||||| |  ||||  |||||  ||||     |||||| a
3'  gggu   guuug ug auucuu u  uauu  aucaa  auga     ucucuu c
   g    -aa     -  g      u gg    --     aa    aaaau      u 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 83400996-83401102 [-]
sense
OTTMUST00000091510 ; Tet3-001; intron 3
OTTMUST00000091511 ; Tet3-002; intron 3
ENSMUST00000056191 ; Tet3-002; intron 3
ENSMUST00000089622 ; Tet3-001; intron 3
Database links

Mature sequence mmu-miR-6374

Accession MIMAT0025118
Sequence

22 - 

aaguuauaagcuaguuggugcu

 - 43

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).