Stem-loop sequence mmu-mir-6373

AccessionMI0021902 (change log)
Symbol MGI:Mir6373
DescriptionMus musculus miR-6373 stem-loop
Stem-loop
   a  u     a    c    cu        -   --     -uuu    ucau 
5'  gg gggug cuuu auuu  gcuuucua aua  cucau    ucau    u
    || ||||| |||| ||||  |||||||| |||  |||||    ||||     
3'  cc cccac ggag uaga  uggaggau uau  gggua    ggug    u
   a  u     c    u    ag        c   aa     uuuc    uccu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 102794384-102794485 [+]
intergenic
Database links

Mature sequence mmu-miR-6373

Accession MIMAT0025117
Sequence

62 - 

uaugggaauaucuaggagguga

 - 83

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).