Stem-loop sequence mmu-mir-6369

AccessionMI0021898 (change log)
Symbol MGI:Mir6369
DescriptionMus musculus miR-6369 stem-loop
Stem-loop
   a     gu -    ca    ag     -   a   u  --      ag   aaaa 
5'  gguca  u ggcu  guuc  uguug gug gug cu  agacac  guu    a
    |||||  | ||||  ||||  ||||| ||| ||| ||  ||||||  |||     
3'  ccggu  a ccga  uagg  acgau uau cgu ga  ucugug  uag    u
   a     ug u    --    ag     g   a   u  uc      cu   acga 
Get sequence
Deep sequencing
729 reads, 115 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 58313044-58313149 [-]
sense
ENSMUST00000043605 ; Kif27-201; intron 11
Database links

Mature sequence mmu-miR-6369

Accession MIMAT0025113
Sequence

9 - 

uggcucaguucaguguuggugag

 - 31

Get sequence
Deep sequencing124 reads, 8 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).