Stem-loop sequence mmu-mir-6368

AccessionMI0021897 (change log)
Symbol MGI:Mir6368
DescriptionMus musculus miR-6368 stem-loop
Stem-loop
   g    -a  u     ac u    a   ug  a         ca   ca 
5'  agga  ug ccagc  g cuuc cuc  uu uuuccuaga  ggg  u
    ||||  || |||||  | |||| |||  || |||||||||  |||   
3'  uccu  ac ggucg  c gagg gag  ga gaagggucu  ucc  g
   -    cg  -     -a -    g   gu  c         cc   aa 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 28710781-28710873 [-]
sense
OTTMUST00000001268 ; RP23-143O13.1-001; intron 3
OTTMUST00000001270 ; RP23-143O13.1-003; intron 3
OTTMUST00000084477 ; RP23-143O13.1-006; intron 3
ENSMUST00000148885 ; 2610307P16Rik-001; intron 3
ENSMUST00000125358 ; 2610307P16Rik-003; intron 3
ENSMUST00000134624 ; 2610307P16Rik-006; intron 3
Database links

Mature sequence mmu-miR-6368

Accession MIMAT0025112
Sequence

58 - 

cugggaagcaguggaggggag

 - 78

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).