Stem-loop sequence mmu-mir-6365

AccessionMI0021894 (change log)
Symbol MGI:Mir6365
DescriptionMus musculus miR-6365 stem-loop
Stem-loop
   u    -     ---  -          ucu    -gua    ac         a 
5'  cugu ucuug   ag ggauuccgau   aaua    gaag  cuggguuag a
    |||| |||||   || ||||||||||   ||||    ||||  |||||||||  
3'  gaca agaau   uc uuugggguug   uuau    uuuc  gauucgguc a
   u    g     acg  g          --u    auaa    -c         u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 13471080-13471180 [-]
intergenic
Database links

Mature sequence mmu-miR-6365

Accession MIMAT0025109
Sequence

57 - 

uuagccuuuaauauauuuguug

 - 78

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).