Stem-loop sequence mmu-mir-6358

AccessionMI0021886 (change log)
Symbol MGI:Mir6358
DescriptionMus musculus miR-6358 stem-loop
Stem-loop
   c    ugu  ca        -    aauuc   ug   u     -a    -   aa 
5'  ccag   gg  guauacag cuau     cac  agg gauau  cacc cau  u
    ||||   ||  |||||||| ||||     |||  ||| |||||  |||| |||  c
3'  gguu   cc  uauauguu ggua     gug  ucc cugua  gugg gug  c
   a    ---  --        u    -----   ua   -     cg    u   ac 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 76170552-76170652 [+]
intergenic
Database links

Mature sequence mmu-miR-6358

Accession MIMAT0025101
Sequence

3 - 

caguguggcaguauacagcuaua

 - 25

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).