Stem-loop sequence mmu-mir-6357

AccessionMI0021885 (change log)
Symbol MGI:Mir6357
DescriptionMus musculus miR-6357 stem-loop
Stem-loop
   -   -   aca     g gcuu u      -   c       gagag    -   a 
5'  gua cuu   aaggc c    g cggugu agg agggguu     ggac guu g
    ||| |||   ||||| |    | |||||| ||| |||||||     |||| |||  
3'  cgu gga   uuucg g    c gucacg uuc uucccgg     ccug cga g
   a   u   --c     g -acu -      a   u       --aua    a   u 
Get sequence
Deep sequencing
8 reads, 57.1 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 70516786-70516889 [+]
antisense
OTTMUST00000089337 ; Poli-002; intron 9
OTTMUST00000067450 ; Poli-001; intron 9
OTTMUST00000089338 ; Poli-003; intron 9
OTTMUST00000089339 ; Poli-004; intron 9
ENSMUST00000161542 ; Poli-002; intron 9
ENSMUST00000121674 ; Poli-001; intron 9
ENSMUST00000159389 ; Poli-003; intron 9
ENSMUST00000160713 ; Poli-004; intron 9
ENSMUST00000043286 ; Poli-201; intron 9
Database links

Mature sequence mmu-miR-6357

Accession MIMAT0025100
Sequence

77 - 

uagcacugcucagggcuuucagg

 - 99

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).