Stem-loop sequence mmu-mir-6356

AccessionMI0021884 (change log)
Symbol MGI:Mir6356
DescriptionMus musculus miR-6356 stem-loop
Stem-loop
   c   -- -   a     aacaa  ac       au   a  ----   -   c   g 
5'  ucc  c cag guccu     ug  uuauaua  ggc gu    uca gca uga a
    |||  | ||| |||||     ||  |||||||  ||| ||    ||| ||| |||  
3'  agg  g guc cggga     ac  agugugu  ccg cg    agu cgu auu c
   a   ac u   a     ---cg  --       gu   a  gaga   a   -   c 
Get sequence
Deep sequencing
10 reads, 133 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 68739400-68739501 [+]
intergenic
Database links

Mature sequence mmu-miR-6356

Accession MIMAT0025099
Sequence

2 - 

uccccagaguccuaacaauga

 - 22

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).