Stem-loop sequence mmu-mir-6355

AccessionMI0021883 (change log)
Symbol MGI:Mir6355
DescriptionMus musculus miR-6355 stem-loop
Stem-loop
   a         u acau      g uc  a       uc   acuc  -       c 
5'  gcuaugcug g    cacaau c  ca ugugaua  aca    ca uauugug c
    ||||||||| |    |||||| |  || |||||||  |||    || |||||||  
3'  ugauacgac c    guguua g  gu guauuau  ugu    gu gugacac a
   g         - ----      - uc  a       uu   -cau  c       a 
Get sequence
Deep sequencing
14 reads, 1.43e+03 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 59579630-59579735 [+]
intergenic
Database links

Mature sequence mmu-miR-6355

Accession MIMAT0025098
Sequence

17 - 

cacaaugcuccaaugugauau

 - 37

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).