Stem-loop sequence mmu-mir-6351

AccessionMI0021879 (change log)
Symbol MGI:Mir6351
DescriptionMus musculus miR-6351 stem-loop
Stem-loop
   u     u      -   gcaca      -a       aau    ga    a 
5'  agcgu gcucag gga     uguagg  aagcuga   ggag  cgga c
    ||||| |||||| |||     ||||||  |||||||   ||||  ||||  
3'  ucgua cggguc ccu     acguuu  uuugacu   uuuc  guuu a
   c     -      u   -agag      cg       -cg    ag    c 
Get sequence
Deep sequencing
11 reads, 440 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 73855477-73855575 [-]
intergenic
Database links

Mature sequence mmu-miR-6351

Accession MIMAT0025094
Sequence

1 - 

uagcguugcucagggagcacaug

 - 23

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).