Stem-loop sequence mmu-mir-6350

AccessionMI0021878 (change log)
Symbol MGI:Mir6350
DescriptionMus musculus miR-6350 stem-loop
Stem-loop
   c      -auag    u    uau      u   u   c     -auug    a 
5'  caaugu     cagg gcau   aaauau ggu gag augug     auac c
    ||||||     |||| ||||   |||||| ||| ||| |||||     |||| a
3'  guugca     guuc cgua   uuuaua cua uuc uauac     uaug g
   c      cacga    -    -cu      -   -   a     cauca    u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 47467021-47467125 [-]
intergenic
Database links

Mature sequence mmu-miR-6350

Accession MIMAT0025093
Sequence

9 - 

uagcaggugcauuauaaauau

 - 29

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).