Stem-loop sequence mmu-mir-6349

AccessionMI0021877 (change log)
Symbol MGI:Mir6349
DescriptionMus musculus miR-6349 stem-loop
Literature search

1 open access papers mention mmu-mir-6349
(1 sentences)

Stem-loop
   g    g ga     u  -a          ---      a  aagcua     c 
5'  cucu a  auucu ua  ucccucccac   ccacag gu      acagc u
    |||| |  ||||| ||  ||||||||||   |||||| ||      |||||  
3'  gagg u  uaagg gu  ggggagggug   gguguc ca      ugucg c
   g    g -g     c  ac          uaa      -  -----a     c 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 39186896-39186992 [-]
intergenic
Database links

Mature sequence mmu-miR-6349

Accession MIMAT0025092
Sequence

64 - 

uggaaugugggaggggcaugcg

 - 85

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).