Stem-loop sequence mmu-mir-6348

AccessionMI0021876 (change log)
Symbol MGI:Mir6348
DescriptionMus musculus miR-6348 stem-loop
Stem-loop
   --g     ------     aaa     uuu      u     -   gg   ----      agaa  aa 
5'    gcaca      aaagg   ggugg   guacau cuagu ccu  gcu    uugggu    gg  c
      |||||      |||||   |||||   |||||| ||||| |||  |||    ||||||    ||   
3'    ugugu      uuucc   ucacu   caugua gauca gga  cga    agccca    cc  a
   aug     ggaaua     gac     --u      -     a   gg   uggu      ----  gg 
Get sequence
Deep sequencing
10 reads, 14.3 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 168490643-168490762 [+]
intergenic
Database links

Mature sequence mmu-miR-6348

Accession MIMAT0025091
Sequence

98 - 

ucagccuuuauaaggugugugu

 - 119

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).