Stem-loop sequence mmu-mir-6347

AccessionMI0021875 (change log)
Symbol MGI:Mir6347
DescriptionMus musculus miR-6347 stem-loop
Stem-loop
   c    c    ggcu     -   uu   cua      c   c a   g       
5'  agug ggcu    ggaga ugc  ggg   gggcuc gcc c gaa uucuga 
    |||| ||||    ||||| |||  |||   |||||| ||| | ||| ||||| a
3'  ucac ucga    uuucu acg  ucc   cccgag cgg g cuu aggacu 
   -    -    acac     g   --   ---      u   u a   a       
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 167290125-167290225 [+]
intergenic
Database links

Mature sequence mmu-miR-6347

Accession MIMAT0025090
Sequence

1 - 

cagugcggcuggcuggagaugc

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).