Stem-loop sequence mmu-mir-6344

AccessionMI0021872 (change log)
Symbol MGI:Mir6344
DescriptionMus musculus miR-6344 stem-loop
Stem-loop
   u      a          acu      -    ua  uuu  -a  ug cu   uu 
5'  uuuccu cuguuuuccu   guuucc cuuu  gg   ug  au  u  gug  g
    |||||| ||||||||||   |||||| ||||  ||   ||  ||  |  |||  a
3'  gaagga gacaagaggg   uagagg gaga  cc   ac  ug  g  uac  g
   c      g          ---      u    --  --u  gg  gu uu   uc 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 82131916-82132019 [+]
intergenic
Database links

Mature sequence mmu-miR-6344

Accession MIMAT0025087
Sequence

11 - 

guuuuccuacuguuucccuuuu

 - 32

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).