Stem-loop sequence mmu-mir-6337

AccessionMI0021865 (change log)
Symbol MGI:Mir6337
DescriptionMus musculus miR-6337 stem-loop
Stem-loop
   --    a  u    -        u  ua    aga    -----g   ---a    gag 
5'   ucua ca uuca caguccuu uc  ucca   agag      ugu    gggg   g
     |||| || |||| |||||||| ||  ||||   ||||      |||    ||||    
3'   ggau gu gggu gucgggag ag  aggu   ucuc      aca    uccc   a
   uu    c  u    c        u  --    --g    acugua   aaug    aca 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 65364296-65364400 [-]
intergenic
Database links

Mature sequence mmu-miR-6337

Accession MIMAT0025080
Sequence

82 - 

ugagggcugcuggguugcuaggu

 - 104

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).