Stem-loop sequence mmu-mir-6335

AccessionMI0021862 (change log)
Symbol MGI:Mir6335
DescriptionMus musculus miR-6335 stem-loop
Stem-loop
   a   g   acaca     --         gga    --gua      -----   a 
5'  ucu cau     gugau  auucugcau   cagu     ggcauu     ucu a
    ||| |||     |||||  |||||||||   ||||     ||||||     |||  
3'  agg gua     cauug  uaagaugug   guca     ucguag     aga c
   c   a   -----     ag         --a    auuaa      ucaca   a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 67781043-67781140 [+]
sense
OTTMUST00000112460 ; B3galt1-002; intron 1
ENSMUST00000180887 ; B3galt1-002; intron 1
Database links

Mature sequence mmu-miR-6335

Accession MIMAT0025077
Sequence

3 - 

cugcauacacagugauauucug

 - 24

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).