Stem-loop sequence rno-mir-6333

Accession

MI0021859 (change log)

Description

Rattus norvegicus miR-6333 stem-loop

Stem-loop

   ggaaggaguc   g    uuu  uc -      uau     c   cc    -      a 
5'           cag cugc   gg  c ccaggu   ggcug uca  ucca ccugcc g
             ||| ||||   ||  | ||||||   ||||| |||  |||| |||||| a
3'           guc gacg   cc  g gguccg   ccgac agu  aggu ggaugg c
   -----auugc   g    -cc  cu u      --c     a   uc    c      a 

Deep sequencing

42 reads, 0 reads per million, 37 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr5: 153843901-153844011 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021859

Mature sequence rno-miR-6333

• Accession: MIMAT0025074
• Sequence: 64 - uaggcuggacuugaacagcccgc - 86
• Deep sequencing: 23 reads, 20 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:rno-miR-6333
  • miRDB:rno-miR-6333

References

1. PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2. PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).