Stem-loop sequence rno-mir-6330

AccessionMI0021854 (change log)
DescriptionRattus norvegicus miR-6330 stem-loop
Stem-loop
   ---gauggagugcagugugacauuucaug           aauaa          g     uca      gu 
5'                              ugcaugugugu     ccagaucugg ucauu   guacau  a
                                |||||||||||     |||||||||| |||||   ||||||  c
3'                              auguguacaca     ggucuagacc aguaa   uaugug  a
   cccagacggcuacuggaccuagacuaaca           -acug          -     ---      ac 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 113718116-113718254 [-]
intergenic
Database links

Mature sequence rno-miR-6330

Accession MIMAT0025069
Sequence

78 - 

uauaaugaccagaucuggguca

 - 99

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).