![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-6330 |
|||||
Accession | MI0021854 (change log) | ||||
Description | Rattus norvegicus miR-6330 stem-loop | ||||
Stem-loop |
---gauggagugcagugugacauuucaug aauaa g uca gu 5' ugcaugugugu ccagaucugg ucauu guacau a ||||||||||| |||||||||| ||||| |||||| c 3' auguguacaca ggucuagacc aguaa uaugug a cccagacggcuacuggaccuagacuaaca -acug - --- ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-6330 |
|
Accession | MIMAT0025069 |
Sequence |
78 - uauaaugaccagaucuggguca - 99 |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|