Stem-loop sequence rno-mir-6329

AccessionMI0021853 (change log)
DescriptionRattus norvegicus miR-6329 stem-loop
Stem-loop 
   ------aa              au           a     a  guca 
5'         ggugacaguuugca  gugacucagcu ucuga ca    c
           ||||||||||||||  ||||||||||| ||||| ||     
3'         ccacuguuaaacgu  cacugagucga agacu gu    c
   uucguaac              cu           c     -  aacc
Get sequence
Deep sequencing
16733 reads, 4.79 reads per million, 480 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 56629595-56629685 [-]
intergenic
Database links

Mature sequence rno-miR-6329

Accession MIMAT0025068
Sequence

16 -  

aaugugacucagcuaucugaaca

 - 38

Get sequence
Deep sequencing14624 reads, 473 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).