![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-6328 |
|||||
Accession | MI0021852 (change log) | ||||
Description | Rattus norvegicus miR-6328 stem-loop | ||||
Stem-loop |
-- u cu u - a c c g cug 5' gag gcu gg gggaggggg g gggc cagagcag g uucug g ||| ||| || ||||||||| | |||| |||||||| | ||||| g 3' cuc cga uc uccuccucc c cccg gucucguc c gagac c cc - -c u g c a - g ucu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-6328 |
|
Accession | MIMAT0025067 |
Sequence |
57 - aggccugcucugagcccccgc - 77 |
Deep sequencing | 3760 reads, 371 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|