Stem-loop sequence rno-mir-6328

AccessionMI0021852 (change log)
DescriptionRattus norvegicus miR-6328 stem-loop
Stem-loop 
   --   u   cu  u         - a    c        c g     cug 
5'   gag gcu  gg gggaggggg g gggc cagagcag g uucug   g
     ||| |||  || ||||||||| | |||| |||||||| | |||||   g
3'   cuc cga  uc uccuccucc c cccg gucucguc c gagac   c
   cc   -   -c  u         g c    a        - g     ucu
Get sequence
Deep sequencing
3812 reads, 2.42 reads per million, 372 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr20: 3394813-3394909 [+]
antisense
ENSRNOT00000001084 ; Ppp1r18-201; exon 2
Database links

Mature sequence rno-miR-6328

Accession MIMAT0025067
Sequence

57 -  

aggccugcucugagcccccgc

 - 77

Get sequence
Deep sequencing3760 reads, 371 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).