Stem-loop sequence rno-mir-6326

Accession

MI0021850 (change log)

Description

Rattus norvegicus miR-6326 stem-loop

Stem-loop

   ------cu  -   uu      ugaag      ga      -a    guu    a   uu  u 
5'         gc ccu  gagugc     gugcug  guccuu  gcag   gcca gag  gc a
           || |||  ||||||     ||||||  ||||||  ||||   |||| |||  ||  
3'         cg gga  uuuacg     cacgac  caggga  uguc   uggu cuc  cg g
   ucguucuc  a   --      -ugaa      -a      aa    ---    c   --  u 

Deep sequencing

14 reads, 0 reads per million, 11 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 62299339-62299449 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-6326

• rno-mir-6326: chr10: 62299339-62299449 [+]
• rno-mir-22: chr10: 62299592-62299686 [+]

Database links

• miRBase Tracker:MI0021850

Mature sequence rno-miR-6326

• Accession: MIMAT0025065
• Sequence: 64 - cuggucuguaaagggacacagca - 86
• Deep sequencing: 8 reads, 8 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:rno-miR-6326
  • miRDB:rno-miR-6326

References

1. PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2. PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).