Stem-loop sequence rno-mir-6325

AccessionMI0021849 (change log)
DescriptionRattus norvegicus miR-6325 stem-loop
Literature search

2 open access papers mention rno-mir-6325
(4 sentences)

Stem-loop 
   guaauu  -  uu  -   -----    cuu   gcu  c    g    ugcca        c       c     ac 
5'       gu gu  cc ucu     ugaa   gcu   ga cucc cugc     agagucuc gucuggc uuuca  u
         || ||  || |||     ||||   |||   || |||| ||||     |||||||| ||||||| |||||  g
3'       cg ca  gg aga     acuu   cgg   cu gagg gacg     ucucagag cagacug aaagu  a
   -agagu  u  gg  u   ucguu    --c   -ac  u    -    -----        a       -     ca
Get sequence
Deep sequencing
1472 reads, 0 reads per million, 178 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 36729251-36729391 [+]
intergenic
Database links

Mature sequence rno-miR-6325

Accession MIMAT0025064
Sequence

79 -  

aaagucagacagagacucugcag

 - 101

Get sequence
Deep sequencing1438 reads, 173 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).