Stem-loop sequence rno-mir-6323

AccessionMI0021847 (change log)
DescriptionRattus norvegicus miR-6323 stem-loop
Stem-loop 
   -    --ugaau   g  ag   c    g   -       gc g    ag   g 
5'  ucug       gca ug  ugc caga cag gauggag  c ggga  gug c
    ||||       ||| ||  ||| |||| ||| |||||||  | ||||  |||  
3'  agac       ugu ac  acg gucu guc cuaccuc  g uccu  cac c
   c    ugaggag   a  gg   u    g   u       aa g    -g   u
Get sequence
Deep sequencing
13 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 84827032-84827136 [+]
sense
ENSRNOT00000058006 ; A930003A15Rik-201; 3'UTR (exon 1)
Database links

Mature sequence rno-miR-6323

Accession MIMAT0025062
Sequence

61 -  

uggaacuccaucucuggucugugca

 - 85

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).