Stem-loop sequence rno-mir-6322

AccessionMI0021846 (change log)
DescriptionRattus norvegicus miR-6322 stem-loop
Stem-loop 
   --------------     cu      gccuacgg      u        -  gaaa  u     ---uc  u 
5'               caggg  cugugu        uccacu gugcugug gg    ag gcagg     ug a
                 |||||  ||||||        |||||| |||||||| ||    || |||||     ||  
3'               gucuc  gacaca        aggugg cacgguac cc    uc ugucc     ac c
   guccuccuccuucu     ug      --------      -        a  -aug  -     uuucu  g
Get sequence
Deep sequencing
6 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 26825060-26825178 [-]
intergenic
Database links

Mature sequence rno-miR-6322

Accession MIMAT0025061
Sequence

68 -  

ugucuguaccacauggcacggu

 - 89

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).