Stem-loop sequence rno-mir-1298

AccessionMI0021845 (change log)
DescriptionRattus norvegicus miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Stem-loop 
   ggcaaacugaaga   guug   agau       u         u    c             ------       cc 
5'              agu    gag    gaggggu aagaguuca ucgg uguccagauguau      ccaagua  c
                |||    |||    ||||||| ||||||||| |||| |||||||||||||      |||||||   
3'              uca    cuc    cucuucg uuuucaagu aguc acgggucuacaua      gguuuau  u
   ----------agg   ---a   aguu       c         u    a             aauaac       ug
Get sequence
Deep sequencing
119604 reads, 149 reads per million, 231 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 118190212-118190350 [+]
intergenic
Database links

Mature sequence rno-miR-1298

Accession MIMAT0025060
Sequence

41 -  

uucauucggcuguccagaugua

 - 62

Get sequence
Deep sequencing107444 reads, 221 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).