Stem-loop sequence rno-mir-6320

AccessionMI0021843 (change log)
DescriptionRattus norvegicus miR-6320 stem-loop
Stem-loop
   ------------a    cg    aucagg                     g  guuaa   c g   ga 
5'              ugcc  uggc      cccaagugcugagauuacaag ca     agc a gau  g
                ||||  ||||      ||||||||||||||||||||| ||     ||| | |||   
3'              acgg  aucg      ggguucacgacucuaauguuc gu     ucg u cug  a
   gagaacuaggagg    -a    ----ga                     -  acaag   - g   aa 
Get sequence
Deep sequencing
204 reads, 0.806 reads per million, 124 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 42959640-42959760 [-]
intergenic
Database links

Mature sequence rno-miR-6320

Accession MIMAT0025058
Sequence

69 - 

ugaacaugcuuguaaucucagca

 - 91

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).