Stem-loop sequence rno-mir-3075

AccessionMI0021842 (change log)
DescriptionRattus norvegicus miR-3075 stem-loop
Gene family MIPF0001489; mir-3075
Stem-loop 
   -   -  a    cu     ---     u  ugu       ca          a uu  c 
5'  cug cu uuua  cugcg   guuug ac   cugggag  gccaaggaca g  ac u
    ||| || ||||  |||||   ||||| ||   |||||||  |||||||||| |  || c
3'  gac ga gggu  gacgc   cgaac ug   gauccuu  cgguuccugu u  ug u
   a   c  -    cg     acu     c  -ug       -c          c uc  u
Get sequence
Deep sequencing
531 reads, 0 reads per million, 230 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr16: 1822805-1822917 [+]
sense
ENSRNOT00000014004 ; Zmiz1-201; intron 2
Database links

Mature sequence rno-miR-3075

Accession MIMAT0025057
Sequence

26 -  

ugucugggagcagccaaggacaag

 - 49

Get sequence
Deep sequencing524 reads, 229 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).