Stem-loop sequence rno-mir-6319-1

AccessionMI0021841 (change log)
Previous IDsrno-mir-6319
DescriptionRattus norvegicus miR-6319-1 stem-loop
Gene family MIPF0002088; mir-6319
Stem-loop
   ---ucagaaauacucagcaguguua       u      a          g   ugcc      aa 
5'                          gaggagc ggauuc cagggcagug aga    gagagg  u
                            ||||||| |||||| |||||||||| |||    ||||||   
3'                          cuucucg ccugag gucucgucgc ucu    cuuucc  g
   acaagugagacggcuacuucuuuga       u      -          -   --ua      ga 
Get sequence
Deep sequencing
722 reads, 0 reads per million, 239 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 34746552-34746678 [+]
intergenic
Database links

Mature sequence rno-miR-6319

Accession MIMAT0025056
Sequence

72 - 

ucauucucgcugcucuggagu

 - 92

Get sequence
Deep sequencing1414 reads, 235 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).