![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-6319-1 |
|||||
Accession | MI0021841 (change log) | ||||
Previous IDs | rno-mir-6319 | ||||
Description | Rattus norvegicus miR-6319-1 stem-loop | ||||
Gene family | MIPF0002088; mir-6319 | ||||
Stem-loop |
---ucagaaauacucagcaguguua u a g ugcc aa 5' gaggagc ggauuc cagggcagug aga gagagg u ||||||| |||||| |||||||||| ||| |||||| 3' cuucucg ccugag gucucgucgc ucu cuuucc g acaagugagacggcuacuucuuuga u - - --ua ga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-6319 |
|
Accession | MIMAT0025056 |
Sequence |
72 - ucauucucgcugcucuggagu - 92 |
Deep sequencing | 1414 reads, 235 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|