Stem-loop sequence rno-mir-6318

AccessionMI0021840 (change log)
DescriptionRattus norvegicus miR-6318 stem-loop
Stem-loop
   -------g  a  c      c  u    acu      -      ca   a ucccc    gg 
5'         ag ga cggcgg gg cagc   caggcc ugugcc  agg c     gucu  u
           || || |||||| || ||||   |||||| ||||||  ||| |     ||||  u
3'         uc cu gucgcc uc gucg   guccgg acgcgg  ucc g     cgga  c
   aauugaaa  -  c      c  -    -au      g      --   - ----u    aa 
Get sequence
Deep sequencing
5622 reads, 0 reads per million, 383 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 37262625-37262733 [-]
antisense
ENSRNOT00000021362 ; Elmo3-201; 3'UTR (exon 11)
Clustered miRNAs
< 10kb from rno-mir-6318
rno-mir-328achr19: 37263199-37263282 [-]
rno-mir-6318chr19: 37262625-37262733 [-]
Database links

Mature sequence rno-miR-6318

Accession MIMAT0025055
Sequence

63 - 

cugccuggcgcagggccuguag

 - 84

Get sequence
Deep sequencing2217 reads, 297 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).