Stem-loop sequence rno-mir-6318

Accession

MI0021840 (change log)

Description

Rattus norvegicus miR-6318 stem-loop

Stem-loop

   -------g  a  c      c  u    acu      -      ca   a ucccc    gg 
5'         ag ga cggcgg gg cagc   caggcc ugugcc  agg c     gucu  u
           || || |||||| || ||||   |||||| ||||||  ||| |     ||||  u
3'         uc cu gucgcc uc gucg   guccgg acgcgg  ucc g     cgga  c
   aauugaaa  -  c      c  -    -au      g      --   - ----u    aa 

Deep sequencing

5622 reads, 0 reads per million, 383 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr19: 37262625-37262733 [-]
• Overlapping transcripts:

  antisense

  ENSRNOT00000021362 ; Elmo3-201; 3'UTR (exon 11)

Clustered miRNAs

< 10kb from rno-mir-6318

• rno-mir-328a: chr19: 37263199-37263282 [-]
• rno-mir-6318: chr19: 37262625-37262733 [-]

Database links

• miRBase Tracker:MI0021840

Mature sequence rno-miR-6318

• Accession: MIMAT0025055
• Sequence: 63 - cugccuggcgcagggccuguag - 84
• Deep sequencing: 2217 reads, 297 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:rno-miR-6318
  • miRDB:rno-miR-6318

References

1. PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2. PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).