![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-6316 |
|||||
Accession | MI0021838 (change log) | ||||
Description | Rattus norvegicus miR-6316 stem-loop | ||||
Literature search |
1 open access papers mention rno-mir-6316 | ||||
Stem-loop |
-acauc a c c - a gu u ugcuc 5' cac ugu ugu ucugug gc cacag gca gcaugug u ||| ||| ||| |||||| || ||||| ||| ||||||| 3' gug acg acg agacac cg guguc ugu uguacac g acacac c u u a - uc c uuuca |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-6316 |
|
Accession | MIMAT0025053 |
Sequence |
59 - caugucugucucuguggcacaca - 81 |
Deep sequencing | 17 reads, 10 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|