Stem-loop sequence rno-mir-6316

AccessionMI0021838 (change log)
DescriptionRattus norvegicus miR-6316 stem-loop
Literature search

1 open access papers mention rno-mir-6316
(1 sentences)

Stem-loop 
   -acauc   a   c   c      -  a     gu   u       ugcuc 
5'       cac ugu ugu ucugug gc cacag  gca gcaugug     u
         ||| ||| ||| |||||| || |||||  ||| |||||||      
3'       gug acg acg agacac cg guguc  ugu uguacac     g
   acacac   c   u   u      a  -     uc   c       uuuca
Get sequence
Deep sequencing
52 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 278298675-278298775 [+]
intergenic
Database links

Mature sequence rno-miR-6316

Accession MIMAT0025053
Sequence

59 -  

caugucugucucuguggcacaca

 - 81

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).