Stem-loop sequence rno-mir-3102

AccessionMI0021836 (change log)
DescriptionRattus norvegicus miR-3102 stem-loop
Gene family MIPF0001469; mir-3102
Literature search

1 open access papers mention rno-mir-3102
(2 sentences)

Stem-loop 
   ---c      cca  a       a       ---     ggg    g   u     c  g      auugau 
5'     gcagcu   ug gccugug guggcca   gggug   cugg ugg gcagg ag agagcc      c
       ||||||   || ||||||| |||||||   |||||   |||| ||| ||||| || ||||||       
3'     cgucga   ac uggacac caucggu   cccac   gacc acc cgucc uc ucucgg      u
   ugac      --c  a       c       uac     -ga    g   c     c  a      gcguua
Get sequence
Deep sequencing
44838 reads, 2.46 reads per million, 448 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 165921184-165921320 [-]
sense
ENSRNOT00000026047 ; Arhgef17-201; exon 10
ENSRNOT00000031423 ; Arhgef17-202; exon 10
Database links

Mature sequence rno-miR-3102

Accession MIMAT0025051
Sequence

77 -  

cucuacucccugccccagcca

 - 97

Get sequence
Deep sequencing9383 reads, 375 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).