Stem-loop sequence rno-mir-6315

AccessionMI0021835 (change log)
DescriptionRattus norvegicus miR-6315 stem-loop
Stem-loop 
   caccaagcua   ggua      ----        ca   - c     ----c   ca 
5'           gca    ggcucu    ggacagga  ggc c ugagc     agc  c
             |||    ||||||    ||||||||  ||| | |||||     |||   
3'           cgu    cugggg    ccuguccu  ccg g acucg     ucg  c
   ------auca   --ac      aucu        uc   u c     acguc   ag
Get sequence
Deep sequencing
2059 reads, 0 reads per million, 339 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 221433993-221434093 [-]
sense
ENSRNOT00000068285 ; Vps51-201; exon 4
ENSRNOT00000028495 ; Vps51-202; exon 4
Database links

Mature sequence rno-miR-6315

Accession MIMAT0025050
Sequence

21 -  

ucuggacaggacaggcccugagc

 - 43

Get sequence
Deep sequencing1942 reads, 331 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).