Stem-loop sequence rno-mir-3099

AccessionMI0021833 (change log)
DescriptionRattus norvegicus miR-3099 stem-loop
Gene family MIPF0001559; mir-3099
Stem-loop 
   aaac     g     ---   -  ---g   ga          -      c   c    cu  a   uuc 
5'     cucaa ccugc   uga gc    auc  uccccauccc agcuuc uuc agcc  ug ugu   a
       ||||| |||||   ||| ||    |||  |||||||||| |||||| ||| ||||  || |||    
3'     gaguu ggacg   gcu cg    uag  agggguaggg uuggag aag ucgg  ac acg   g
   ----     a     uag   a  agag   aa          g      a   a    au  -   uau
Get sequence
Deep sequencing
15222 reads, 5.07 reads per million, 217 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 70136945-70137073 [-]
intergenic
Database links

Mature sequence rno-miR-3099

Accession MIMAT0025048
Sequence

73 -  

uaggcuagaaagagguugggga

 - 94

Get sequence
Deep sequencing15155 reads, 216 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).