Stem-loop sequence hme-mir-981

AccessionMI0021796 (change log)
DescriptionHeliconius melpomene miR-981 stem-loop
Gene family MIPF0000710; mir-981
Stem-loop
   ------------------agaaa        aauu         -a         a   uaug 
5'                        ccgcacau    cggguuucg  gacgaugaa ccg    u
                          ||||||||    |||||||||  ||||||||| |||     
3'                        ggcgugua    guccaaagc  cuguugcuu ggu    a
   ucuaaaaaaggucaaccucaagc        aaac         ag         -   uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE669806: 67238-67345 [+]
intergenic
Database links

Mature sequence hme-miR-981

Accession MIMAT0024999
Sequence

54 - 

uucguugucgacgaaaccugca

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).