Stem-loop sequence hme-mir-306

AccessionMI0021770 (change log)
DescriptionHeliconius melpomene miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
      gac  ga  gg  g -g          g        -c      u     a       ugg 
5' cgc   gu  cg  gu g  gcggccgcgc cgucgugu  agguac aggug cucugag   a
   |||   ||  ||  || |  |||||||||| ||||||||  |||||| ||||| |||||||   a
3' gcg   ca  gc  ua c  cgccggcgcg gcggcacg  uccgug uccgc gagacuc   u
      --a  ga  ag  g gg          -        ac      c     a       ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (HelMel1.1) Overlapping transcripts
HE669612: 9804-9929 [-]
intergenic
Clustered miRNAs
< 10kb from hme-mir-306
hme-mir-9aHE669612: 10280-10390 [-]
hme-mir-306HE669612: 9804-9929 [-]
hme-mir-79HE669612: 9681-9765 [-]
Database links

Mature sequence hme-miR-306

Accession MIMAT0024975
Sequence

38 - 

ucagguacuaggugacucuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).