Stem-loop sequence ppe-MIR394a

AccessionMI0021616 (change log)
DescriptionPrunus persica miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention ppe-MIR394a
(4 sentences)

Stem-loop 
   -      a      c uuu  u          -      u c           u --------      ---u   u 
5'  ggguuu gcaaag g   cu acagaguuua uuggca u uguccaccucc c        ucuuuu    cac c
    |||||| |||||| |   || |||||||||| |||||| | ||||||||||| |        ||||||    ||| c
3'  cccaaa uguuuc c   gg ugucucgagu aaccgu a acggguggagg g        agaaga    gug c
   u      a      u uuc  u          c      c u           u ugcaugau      uuau   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 33109945-33110088 [-]
intergenic
Database links

Mature sequence ppe-miR394a

Accession MIMAT0031167
Sequence

32 -  

uuggcauucuguccaccucc

 - 51

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).