Stem-loop sequence ppe-MIR482a

AccessionMI0021609 (change log)
DescriptionPrunus persica miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

2 open access papers mention ppe-MIR482a
(6 sentences)

Stem-loop 
   a       ---a        u     -  a      gc          aca      u  ucc 
5'  agaggaa    uggaaauu uuggg ug gagguu  cggaaagaau   uaauau ca   a
    |||||||    |||||||| ||||| || ||||||  ||||||||||   |||||| ||   a
3'  uuuccuu    accuuuag aaccu ac cuccaa  gccuuucuua   auuaua gu   g
   -       aucg        u     u  c      -a          --a      -  uuu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 30620009-30620128 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR482a
ppe-MIR482achrG1: 30620009-30620128 [+]
ppe-MIR482echrG1: 30620690-30620817 [+]
ppe-MIR482bchrG1: 30622467-30622602 [+]
ppe-MIR482fchrG1: 30625526-30625670 [+]
Database links

Mature sequence ppe-miR482a-5p

Accession MIMAT0031165
Sequence

21 -  

gggugagagguugccggaaaga

 - 42

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ppe-miR482a-3p

Accession MIMAT0027272
Sequence

79 -  

uuuccgaaaccucccauuccaa

 - 100

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).