Stem-loop sequence osa-MIR6250

Accession

MI0021600 (change log)

Description

Oryza sativa miR6250 stem-loop

Literature search

4 open access papers mention osa-MIR6250
(16 sentences)

Stem-loop

   uguuuuu      uu  -     a  -       cuugu      ua      -g       auau 
5'        uuucuu  ug guuga uc guccucu     ucuugu  aggugg  ggcacca    a
          ||||||  || ||||| || |||||||     ||||||  ||||||  |||||||    u
3'        aaagaa  gc cagcu ag uagggga     agagcg  ucuacc  ccguggu    c
   cuuugcu      cu  g     -  a       -----      uc      ga       acca 

Deep sequencing

24 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr6: 28264615-28264740 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021600

Mature sequence osa-miR6250

• Accession: MIMAT0024873
• Sequence: 95 - ggggauagaucgacgcgucaag - 116
• Deep sequencing: 23 reads, 2 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).