Stem-loop sequence osa-MIR5337b

AccessionMI0021597 (change log)
DescriptionOryza sativa miR5337b stem-loop
Literature search

1 open access papers mention osa-MIR5337b
(1 sentences)

Stem-loop
   -    -           a                  -  acu       ca   c   uuuucac    c    u               g       gcaauauauauuauggaaguauuucuc 
5'  ccuc cauuucaaauu cuugucguucuagcuuug cc   agucaaa  uuu uau       cauc auuu uggaaauucguguag uuaacau                           a
    |||| ||||||||||| |||||||||||||||||| ||   |||||||  ||| |||       |||| |||| ||||||||||||||| |||||||                            
3'  gggg guaaaguuuaa gaacggcaagaucgaaac gg   uuaguuu  aaa aua       guag ugaa aucuuuaaguauauc aauugua                           u
   a    a           c                  a  -au       ac   u   ----cuu    u    c               a       guauuccaaauacaaaaaucuaagugg 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 35885481-35885724 [-]
intergenic
Database links

Mature sequence osa-miR5337b

Accession MIMAT0024870
Sequence

214 - 

cuagaacggcaagcaauuuga

 - 234

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).