Stem-loop sequence rno-mir-3473

AccessionMI0021538 (change log)
DescriptionRattus norvegicus miR-3473 stem-loop
Literature search

6 open access papers mention rno-mir-3473
(9 sentences)

Stem-loop 
   a    --    cua     -     caa     aa 
5'  ucac  aguc   uuucu gcccu   agaca  a
    ||||  ||||   ||||| |||||   |||||  a
3'  ggug  ucgg   agagg cggga   ucugu  u
   g    aa    uag     u     ---     ag
Get sequence
Deep sequencing
16890 reads, 3.47e+03 reads per million, 462 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 44719335-44719401 [+]
antisense
ENSRNOT00000005355 ; Zranb3-201; intron 6
ENSRNOT00000068466 ; Zranb3-202; intron 6
ENSRNOT00000067965 ; Zranb3-203; intron 6
ENSRNOT00000066136 ; Zranb3-204; intron 6
Database links

Mature sequence rno-miR-3473

Accession MIMAT0024853
Sequence

40 -  

ucuagggcuggagagauggcua

 - 61

Get sequence
Deep sequencing16886 reads, 465 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22470567 "Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation" Meng F, Hackenberg M, Li Z, Yan J, Chen T PLoS One. 7:e34394(2012).