![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-1843a |
|||||
Accession | MI0021535 (change log) | ||||
Previous IDs | rno-mir-1843 | ||||
Description | Rattus norvegicus miR-1843a stem-loop | ||||
Gene family | MIPF0001119; mir-1843 | ||||
Literature search |
![]()
5 open access papers mention rno-mir-1843a | ||||
Stem-loop |
a cuacaugaa -cu u u aau 5' gcgguc uauggaggu c guc gacuuag a |||||| ||||||||| | ||| ||||||| g 3' ugucag auaccucca g uag cugaauc u c auuuucaac cuu c u ggu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence rno-miR-1843a-5p |
|
Accession | MIMAT0024847 |
Previous IDs | rno-miR-1843-5p |
Sequence |
17 - uauggaggucucugucugacu - 37 |
Deep sequencing | 167179 reads, 497 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
Mature sequence rno-miR-1843a-3p |
|
Accession | MIMAT0024848 |
Previous IDs | rno-miR-1843-3p |
Sequence |
55 - ucugaucguucaccuccauaca - 76 |
Deep sequencing | 6721 reads, 432 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22470567
"Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation"
PLoS One. 7:e34394(2012).
|
2 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
3 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|