Stem-loop sequence hvu-MIR5049c

AccessionMI0021493 (change log)
DescriptionHordeum vulgare miR5049c stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention hvu-MIR5049c
(4 sentences)

Stem-loop
   guuuc       c              a     ------------   cc        g 
5'      uacuucc cuguuccaaaauaa ugucu            caa  uuguacua c
        ||||||| |||||||||||||| |||||            |||  ||||||||  
3'      augaagg ggcaggguuuuauu acaga            guu  aauaugau u
   uuauu       a              a     ucuccgaaucau   aa        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5049c

Accession MIMAT0024803
Sequence

76 - 

agacaauuauuuugggacggagg

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).