Stem-loop sequence hvu-MIR5049b

AccessionMI0021487 (change log)
DescriptionHordeum vulgare miR5049b stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention hvu-MIR5049b
(4 sentences)

Stem-loop
   aucacuau        g      ac        ua  u         ug 
5'         uacucccu uguauc  aauacuug  gu gggggcacu  u
           |||||||| ||||||  ||||||||  || |||||||||   
3'         augaggga acaugg  uuaugaac  ca cccuuguga  a
   cuucaang        g      au        --  c         uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5049b

Accession MIMAT0024797
Sequence

68 - 

aguauuuagguacagagggag

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).