Stem-loop sequence bta-mir-2285k-1

AccessionMI0021135 (change log)
DescriptionBos taurus miR-2285k-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285k-1
(16 sentences)

Stem-loop 
   aug  -          gc  g a           g 
5'    gg caaaaaguuu  uu g uuuuucuguga a
      || ||||||||||  || | |||||||||||  
3'    uc guuuuucaag  ag c aaaaggguauu u
   -ag  a          ua  g c           a
Get sequence
Deep sequencing
8945 reads, 205 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 10896396-10896465 [+]
intergenic
Database links

Mature sequence bta-miR-2285k

Accession MIMAT0024586
Sequence

45 -  

aaaaccggaaugaacuuuuug

 - 65

Get sequence
Deep sequencing47879 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).