Stem-loop sequence bta-mir-2285g-1

AccessionMI0021130 (change log)
DescriptionBos taurus miR-2285g-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285g-1
(15 sentences)

Stem-loop 
              ca   -  a      ugua 
5' gccaaaaaguu  uuc gg uuuucc    a
   |||||||||||  ||| || ||||||     
3' cgguuuuucga  aag cc aaaagg    g
              ac   u  a      uaua
Get sequence
Deep sequencing
3672 reads, 11 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 25160438-25160498 [+]
intergenic
Database links

Mature sequence bta-miR-2285g

Accession MIMAT0024582
Sequence

40 -  

aaaccugaacaagcuuuuugg

 - 60

Get sequence
Deep sequencing5359 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).