![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-2285f-2 |
|||||
Accession | MI0021129 (change log) | ||||
Description | Bos taurus miR-2285f-2 stem-loop | ||||
Gene family | MIPF0000747; mir-2284 | ||||
Literature search |
![]()
13 open access papers mention bta-mir-2285f-2 | ||||
Stem-loop |
uac a ug --u a 5' uauuggguuggccagaaa uu uucagguuuuuc gu c |||||||||||||||||| || |||||||||||| || a 3' auaaccuaaccgguuuuu aa aaguccaaaaag cg a uau c gu uau u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-2285f |
|
Accession | MIMAT0024581 |
Sequence |
54 - aaaaccugaaugaacuuuuugg - 75 |
Deep sequencing | 28344 reads, 77 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22298343
"Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells"
J Cell Biochem. 113:2098-2111(2012).
|