![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-2284y-1 |
|||||
Accession | MI0021125 (change log) | ||||
Description | Bos taurus miR-2284y-1 stem-loop | ||||
Gene family | MIPF0000747; mir-2284 | ||||
Literature search |
![]()
13 open access papers mention bta-mir-2284y-1 | ||||
Stem-loop |
aauaaccccuguua - ac cuugauc g c c u uu 5' aggccug caga uug uauuggguuggccaaaaa uu guu ggg uu c ||||||| |||| ||| |||||||||||||||||| || ||| ||| || 3' uucgggu gucu aac auaacccaaccgguuuuu aa caa ccc ga c ------------cc u -- ------- g u a u uu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-2284y |
|
Accession | MIMAT0024579 |
Sequence |
52 - aaaaguucguucggguuuuuc - 72 |
Deep sequencing | 491587 reads, 77 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22298343
"Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells"
J Cell Biochem. 113:2098-2111(2012).
|
2 |
PMID:21912509
"Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle"
Int J Biol Sci. 7:1016-1026(2011).
|