Stem-loop sequence ppy-mir-454

AccessionMI0020915 (change log)
DescriptionPongo pygmaeus miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   aaaaaauucuguuug  a     uc            ---         ----   --u     g 
5'                uc ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
                  || |||||  ||||||||||||   |||||||||    |||   |||||  
3'                ag gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
   -----------aaga  -     gu            uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
NW_002962513.1: 2376800-2376910 [+]
intergenic
Database links

Mature sequence ppy-miR-454

Accession MIMAT0024367
Sequence

71 - 

uagugcaauauugcuuauaggg

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).