Stem-loop sequence mml-mir-320c

AccessionMI0020874 (change log)
DescriptionMacaca mulatta miR-320c stem-loop
Gene family MIPF0000163; mir-320
Literature search

2 open access papers mention mml-mir-320c
(3 sentences)

Stem-loop
   aggagcacuggguauguacaaauaaaauggcauggcag     c  uu       c     ag 
5'                                       gccuu uc  uccaguu uuccc  a
                                         ||||| ||  ||||||| |||||   
3'                                       uggga ag  gggucga aaggg  a
   -------------------uaaacaaaaagaaaaaaaa     c  uu       a     uu 
Get sequence
Deep sequencing
6934 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 12807569-12807677 [+]
antisense
ENSMMUT00000012026 ; ZNF521-202; intron 2
ENSMMUT00000029919 ; ZNF521-201; intron 3
Database links

Mature sequence mml-miR-320c

Accession MIMAT0024326
Sequence

71 - 

aaaagcuggguugacaggguaa

 - 92

Get sequence
Deep sequencing6930 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).